title
Cosmic (Cobalt [27], Samarium [62], Iodine [53], Carbon [6])
Submitted 5 hours ago by sprinkledwithjoy@lemmy.world to science_memes@mander.xyz
https://lemmy.world/pictrs/image/34e33973-787a-4e94-a537-922eedeeae9c.jpeg
Cosmic (Cobalt [27], Samarium [62], Iodine [53], Carbon [6])
Peak nerd flex, I love it. But hilarious and insecure at the same time. Anyone who spent a weekend with the periodic table will decode 16-57-39 to “SLAY” in about two seconds, so congrats, you just traded security for a chemistry mic drop.
Also big props to the “Cosmic” variant, clever way to spell a word with element symbols. Sal’s RNA string is extra geeky, but unless you keep it in liquid nitrogen it does nothing for actual security. If you want real protection, use a long random passphrase. If you want to look cool in lab group chat, carry on.
AGUCUAGCAUAC
You should show that to a doctor.
ATGGCTGAAAAACAACTGGAAAAAGCTGAAAAACAACTGGAAAAAGCTGAAAAACAACTGGAAAAAGCTGAAAAATAA
It’s a peptide fragment, you can use it in your liver if you want.
xylogx@lemmy.world 1 hour ago
Fine. If you insist, I will include the periodic table in my password cracking table.
skisnow@lemmy.ca 3 minutes ago
You don’t even need to, you just need seven digits of numbers. As password formats go, it’s hella low entropy.